px330 mcherry vector (Addgene inc)
Addgene inc is a verified supplier 
95
Structured Review
Addgene inc
px330 mcherry vector
Px330 Mcherry Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 98 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/px330+mcherry+vector/px330-mcherry+(Plasmid+%2398750)/pmc12618760-197-9-11
Average 95 stars, based on 98 article reviews
Px330 Mcherry Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 98 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/px330+mcherry+vector/px330-mcherry+(Plasmid+%2398750)/pmc12618760-197-9-11
Average 95 stars, based on 98 article reviews
px330 mcherry vector - by Bioz Stars,
2026-10
95/100 stars
Images
Related Articles
other:Article Title: Single-stranded DNA binding proteins are essential components of the architectural LDB1 protein complex Article Snippet: A DNA fragment containing LHA (1180 bp left homology arm)-eGFP-mAID-2xFLAG-RHA (1276 bp right homology arm) were cloned into Zero Blunt TOPO vector (Invitrogen, 450245), amplified by Phusion (NEB, M0531S) and purified with the QIAquick PCR Purification Kit (QIAGEN, 21804). Article Title: Single-stranded DNA binding proteins are essential components of the architectural LDB1 protein complex Article Snippet: sgRNA synthetic oligonucleotides targeting SSBP2 (TGAGCTCCTACATGGAGCAGATA), SSBP3 (TACGTCTACGAATATTTACTGCA), and SSBP4 (GCCTCACTGGAGTGTTCACAGGC) LUFS domains (Eurofins Genomics) were subcloned into Article Title: Single-stranded DNA binding proteins are essential components of the architectural LDB1 protein complex Article Snippet: 6 ug PCR product and 18 ug pX330-mCherry plasmid were electroporated into G1E-ER4 cells using the Amaxa II electroporator (Lonza, program G-016) with the Amax II Cell Line Nucleofector Kit (R) (Lonza, VCA-1001). Construct:Article Title: Topoisomerase Inhibitors and PIM1 Kinase Inhibitors Improve Gene Editing Efficiency Mediated by CRISPR-Cas9 and Homology-Directed Repair Article Snippet: .. The designed sgRNA and target sequences ( ) were constructed into the Plasmid Preparation:Article Title: Topoisomerase Inhibitors and PIM1 Kinase Inhibitors Improve Gene Editing Efficiency Mediated by CRISPR-Cas9 and Homology-Directed Repair Article Snippet: .. The designed sgRNA and target sequences ( ) were constructed into the Article Title: Posterior enhancer (p-Enh) maintains early neuromesodermal progenitors bi-potency during gastrulation. Article Snippet: .. Complementary sgRNA oligonucleotides were annealed and cloned into linearized Article Title: Posterior enhancer (p-Enh) maintains early neuromesodermal progenitors bi-potency during gastrulation Article Snippet: .. Complementary sgRNA oligonucleotides were annealed and cloned into linearized Article Title: Expression of tripartite motif family-like protein 1 and 2 in early conceptus development and placentation in the pig Article Snippet: .. Annealed gRNA oligonucleotides were cloned into the Article Title: Single-stranded DNA-binding proteins are essential components of the architectural LDB1 protein complex. Article Snippet: Article Single-stranded DNA-binding proteins are essential components of the architectural LDB1 protein complex Sequencing:Article Title: Topoisomerase Inhibitors and PIM1 Kinase Inhibitors Improve Gene Editing Efficiency Mediated by CRISPR-Cas9 and Homology-Directed Repair Article Snippet: .. The designed sgRNA and target sequences ( ) were constructed into the Clone Assay:Article Title: Posterior enhancer (p-Enh) maintains early neuromesodermal progenitors bi-potency during gastrulation. Article Snippet: .. Complementary sgRNA oligonucleotides were annealed and cloned into linearized Article Title: Posterior enhancer (p-Enh) maintains early neuromesodermal progenitors bi-potency during gastrulation Article Snippet: .. Complementary sgRNA oligonucleotides were annealed and cloned into linearized Article Title: Expression of tripartite motif family-like protein 1 and 2 in early conceptus development and placentation in the pig Article Snippet: .. Annealed gRNA oligonucleotides were cloned into the Article Title: Single-stranded DNA-binding proteins are essential components of the architectural LDB1 protein complex. Article Snippet: Article Single-stranded DNA-binding proteins are essential components of the architectural LDB1 protein complex Expressing:Article Title: Expression of tripartite motif family-like protein 1 and 2 in early conceptus development and placentation in the pig Article Snippet: .. Annealed gRNA oligonucleotides were cloned into the Knock-In:Article Title: Single-stranded DNA-binding proteins are essential components of the architectural LDB1 protein complex. Article Snippet: Article Single-stranded DNA-binding proteins are essential components of the architectural LDB1 protein complex Amplification:Article Title: Single-stranded DNA-binding proteins are essential components of the architectural LDB1 protein complex. Article Snippet: Article Single-stranded DNA-binding proteins are essential components of the architectural LDB1 protein complex Purification:Article Title: Single-stranded DNA-binding proteins are essential components of the architectural LDB1 protein complex. Article Snippet: Article Single-stranded DNA-binding proteins are essential components of the architectural LDB1 protein complex Polymerase Chain Reaction:Article Title: Single-stranded DNA-binding proteins are essential components of the architectural LDB1 protein complex. Article Snippet: Article Single-stranded DNA-binding proteins are essential components of the architectural LDB1 protein complex |